Classic technology

Classic technology

• Classic technology

• Developed in the 1970’s by Frederick Sanger

• An important tool in molecular biology

• We use a slight variation of the original method called chain-termination

• DNA samples are sent to the Centre for processing

• Controls are run with every tray and pre checked on a Nanodrop

• Chemical reactions called “cycle sequencing” performed on a thermal cycler 9700 using BigDye Terminator v3.1 kits

Incorporation of four fluorescent dyes that bind specifically to the four nucleotides

• Incorporation of four fluorescent dyes that bind specifically to the four nucleotides

• DNA nucleotides A,C,G,T (adenine, cytosine, guanine and thymine)

• Thousands of copies are produced that are different lengths

• Samples purified using magnetic bead technology

• Samples sequenced on a 3130XL Genetic Analyzer

• DNA products separated by size (like agarose gel electrophoresis)

Good quality sequence data, with sharp peaks, no N’s and high quality value scores

• Good quality sequence data, with sharp peaks, no N’s and high quality value scores

• * Check sample using a Nanodrop. Check for contaminants.

• * Check the primer melting temperature. Use a software programme eg Primer Express.

• * Submit samples at the correct concentrations. Use water not EDTA or TRIS.

• * Ask for us to add DMSO (dimethyl sulphate) if secondary structure problems.

• * For Ethanol ppte always use fresh stocks and ensure it is completely removed.

Contaminants such as excess salt, RNA or protein in your sample:

• Contaminants such as excess salt, RNA or protein in your sample:

• These cause the bands to be distorted and wide and the quality scores are low.

• The software has problems calling the right bases.

Effect of too much residual salt

• Effect of too much residual salt

• Across the gel image the sequence gradually deteriorates with increasing amounts of sodium chloride, NaCl.

• Lane 1 no added salt

• Lanes 2-11 salt added in 10mM increments from 10-100mM.

Effect of too much residual ethanol

• Effect of too much residual ethanol

• Excess dye blobs are seen in samples in lane 1 & 2 with incomplete removal of ethanol.

Effect of marker pen written on top of trays

• Effect of marker pen written on top of trays

• Always write your name on the side of 96 well trays as problems with leakage.

Sample Requirements

• Sample Requirements

• Please supply your templates as detailed below:

• Book through iLab at http://asas-centres.ilabsolutions.com

• My recommendation:

• For full service, 1/4 BigDye is the best option for plasmids.

TNGATTATCGTGAAAAACGAACCTAATAGCGGCTGCAGACCATTAGGATTTCCTGATCCAAATCGAGGTCGTAGAAACCCCTTTCGTTATGGCTAAAAAGGGGATTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCAGAATTTCTGTTAATTAAGGAGCGGGAGCTCTAGGTTGTAGGAAAAGTATCCCGTTCAAGGTGGGGTTTTGTATTCCCCGCGGTCGCCCCAACCAAAGACATAGAGTAGGGTTATAGGGGTTTTAACTTGAGGGCTACTTTGGTGTCTAAAGTTCTTAGGGTATCGTTATGGCTAAAAAGGGGATTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCAGAATTTCTGTTAATTAAGGA

• TNGATTATCGTGAAAAACGAACCTAATAGCGGCTGCAGACCATTAGGATTTCCTGATCCAAATCGAGGTCGTAGAAACCCCTTTCGTTATGGCTAAAAAGGGGATTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCAGAATTTCTGTTAATTAAGGAGCGGGAGCTCTAGGTTGTAGGAAAAGTATCCCGTTCAAGGTGGGGTTTTGTATTCCCCGCGGTCGCCCCAACCAAAGACATAGAGTAGGGTTATAGGGGTTTTAACTTGAGGGCTACTTTGGTGTCTAAAGTTCTTAGGGTATCGTTATGGCTAAAAAGGGGATTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCAGAATTTCTGTTAATTAAGGA