Classic technology


Download 462 b.
Sana13.09.2017
Hajmi462 b.
#15648





Classic technology

  • Classic technology

  • Developed in the 1970’s by Frederick Sanger

  • An important tool in molecular biology

  • We use a slight variation of the original method called chain-termination

  • DNA samples are sent to the Centre for processing

  • Controls are run with every tray and pre checked on a Nanodrop

  • Chemical reactions called “cycle sequencing” performed on a thermal cycler 9700 using BigDye Terminator v3.1 kits



Incorporation of four fluorescent dyes that bind specifically to the four nucleotides

  • Incorporation of four fluorescent dyes that bind specifically to the four nucleotides

  • DNA nucleotides A,C,G,T (adenine, cytosine, guanine and thymine)

  • Thousands of copies are produced that are different lengths

  • Samples purified using magnetic bead technology

  • Samples sequenced on a 3130XL Genetic Analyzer

  • DNA products separated by size (like agarose gel electrophoresis)



















Good quality sequence data, with sharp peaks, no N’s and high quality value scores

  • Good quality sequence data, with sharp peaks, no N’s and high quality value scores

  • * Check sample using a Nanodrop. Check for contaminants.

  • * Check the primer melting temperature. Use a software programme eg Primer Express.

  • * Submit samples at the correct concentrations. Use water not EDTA or TRIS.

  • * Ask for us to add DMSO (dimethyl sulphate) if secondary structure problems.

  • * For Ethanol ppte always use fresh stocks and ensure it is completely removed.



Contaminants such as excess salt, RNA or protein in your sample:

  • Contaminants such as excess salt, RNA or protein in your sample:

  • These cause the bands to be distorted and wide and the quality scores are low.

  • The software has problems calling the right bases.



Effect of too much residual salt

  • Effect of too much residual salt

  • Across the gel image the sequence gradually deteriorates with increasing amounts of sodium chloride, NaCl.

  • Lane 1 no added salt

  • Lanes 2-11 salt added in 10mM increments from 10-100mM.



Effect of too much residual ethanol

  • Effect of too much residual ethanol

  • Excess dye blobs are seen in samples in lane 1 & 2 with incomplete removal of ethanol.



Effect of marker pen written on top of trays

  • Effect of marker pen written on top of trays

  • Always write your name on the side of 96 well trays as problems with leakage.



Sample Requirements

  • Sample Requirements

  • Please supply your templates as detailed below:



  • Book through iLab at http://asas-centres.ilabsolutions.com

  • My recommendation:

  • For full service, 1/4 BigDye is the best option for plasmids.





TNGATTATCGTGAAAAACGAACCTAATAGCGGCTGCAGACCATTAGGATTTCCTGATCCAAATCGAGGTCGTAGAAACCCCTTTCGTTATGGCTAAAAAGGGGATTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCAGAATTTCTGTTAATTAAGGAGCGGGAGCTCTAGGTTGTAGGAAAAGTATCCCGTTCAAGGTGGGGTTTTGTATTCCCCGCGGTCGCCCCAACCAAAGACATAGAGTAGGGTTATAGGGGTTTTAACTTGAGGGCTACTTTGGTGTCTAAAGTTCTTAGGGTATCGTTATGGCTAAAAAGGGGATTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCAGAATTTCTGTTAATTAAGGA

  • TNGATTATCGTGAAAAACGAACCTAATAGCGGCTGCAGACCATTAGGATTTCCTGATCCAAATCGAGGTCGTAGAAACCCCTTTCGTTATGGCTAAAAAGGGGATTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCAGAATTTCTGTTAATTAAGGAGCGGGAGCTCTAGGTTGTAGGAAAAGTATCCCGTTCAAGGTGGGGTTTTGTATTCCCCGCGGTCGCCCCAACCAAAGACATAGAGTAGGGTTATAGGGGTTTTAACTTGAGGGCTACTTTGGTGTCTAAAGTTCTTAGGGTATCGTTATGGCTAAAAAGGGGATTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCAGAATTTCTGTTAATTAAGGA



Download 462 b.

Do'stlaringiz bilan baham:




Ma'lumotlar bazasi mualliflik huquqi bilan himoyalangan ©fayllar.org 2025
ma'muriyatiga murojaat qiling