A maternal Epimutation of


Download 93.75 Kb.

Sana04.10.2017
Hajmi93.75 Kb.

A Maternal Epimutation of GNAS Leads to Albright

Osteodystrophy and Parathyroid Hormone Resistance

Virginie Mariot,* Ste´phanie Maupetit-Me´houas,* Christiane Sinding, Marie-Laure Kottler, and

Agne`s Linglart

Institut National de la Sante´ et de la Recherche Me´dicale U561 (V.M., S.M.-M., C.S., A.L.) and Paediatric Endocrinology (A.L.), Paris V

University, St-Vincent de Paul Hospital, 75014 Paris, France; and Department of Genetic and Human Reproduction (M.-L.K.), Centre

Hospitalier Universitaire, 14033 Caen, France

Context: Pseudohypoparathyroidism (PHP) type Ia is a rare maternally transmitted disease due to

maternal loss-of-function mutations of GNAS, the gene encoding G

s

, the



␣-stimulatory subunit of

the G protein. Affected individuals display hormonal resistance (mainly PTH and TSH resistance)

and Albright hereditary osteodystrophy. PHP type Ib (PHP-Ib), usually defined by isolated renal

resistance to PTH and sometimes mild TSH resistance, is due to a maternal loss of GNAS exon A/B

methylation, leading to decreased G

s



expression in specific tissues.

Objective and Results: We report a girl with obvious Albright osteodystrophy features, PTH re-

sistance, normal G

s

bioactivity in red blood cells, yet no loss-of-function mutation in the GNAS



coding sequence (exons 1–13). The methylation analysis of the four GNAS differentially methylated

regions, i.e. NESP, AS, XL, and A/B, revealed broad methylation changes at all differentially meth-

ylated regions, including GNAS exon A/B, leading to a paternal epigenotype on both alleles.

Conclusions: This observation suggests that: 1) the decreased expression of G

s



due to GNAS

epimutations is not restricted to the renal tubule but may affect nonimprinted tissues like bone;

2) PHP-Ib is a heterogeneous disorder that should lead to studying GNAS epigenotype in patients

with PHP and no mutation in GNAS exons 1–13, regardless of their physical features. (J Clin En-



docrinol Metab 93: 661– 665, 2008)

T

he association of hypocalcemia, hyperphosphatemia, and

elevated PTH levels in the absence of vitamin D deficiency

defines PTH resistance and pseudohypoparathyroidism (PHP).

The main form of PHP, PHP type Ia (PHP-Ia), is usually de-

scribed as the association of Albright hereditary osteodystrophy

(AHO) (a collection of physical features such as obesity,

brachymetacarpy, brachymetatarsy, short stature, sc ossifica-

tions, and some degree of mental retardation) and resistance to

hormones sharing a signaling pathway through G protein-cou-

pled receptors (PTH, TSH) (1, 2). Most of the PHP-Ia affected

patients carry a maternal loss of function of GNAS, the gene

encoding G

s



, the

␣-stimulatory subunit of the G protein (3, 4).

An approximate 50% decrease in G

s



bioactivity was found in

the cells of most of these patients (2). Few patients exhibit normal

G



s



bioactivity with GTP

␥S (the nonhydrolyzable guanine nu-

cleotide analog) as a stimulant in red blood cells, despite a ma-

ternal loss of function mutation at the C terminal part of G

s

,



likely affecting exclusively the G

s



-receptor interaction (4).

In contrast, PHP type Ib (PHP-Ib) is usually characterized by

isolated hormonal resistance, mainly PTH and sometimes TSH

resistance and the lack of AHO (5). In affected PHP-Ib individ-

uals, Liu et al. (6) identified methylation changes at the GNAS

differentially methylated regions (DMRs), including GNAS

exon A/B (also referred to as exon 1A), as the cause of the de-

creased G

s

expression in target tissues (renal proximal tubule,



thyroid), therefore hormonal resistance. In addition, microdele-

0021-972X/08/$15.00/0

Printed in U.S.A.

Copyright © 2008 by The Endocrine Society

doi: 10.1210/jc.2007-0927 Received April 24, 2007. Accepted December 20, 2007.

First Published Online January 8, 2008

* V.M. and S.M.-M. contributed equally to this work and should be regarded as joint first

authors.


Abbreviations: AHO, Albright hereditary osteodystrophy; CTRL, control; DMR, differen-

tially methylated region; PHP, pseudohypoparathyroidism; PHP-Ia, PHP type Ia; PHP-Ib, PHP

type Ib.

S P E C I A L

F E A T U R E

C l i n i c a l

C a s e

S e m i n a r



J Clin Endocrinol Metab, March 2008, 93(3):661– 665

jcem.endojournals.org



661

Downloaded from https://academic.oup.com/jcem/article-abstract/93/3/661/2597993/A-Maternal-Epimutation-of-GNAS-Leads-to-Albright

by guest

on 03 October 2017



tions within the STX16 gene (STXdel4 – 6

mat


, STXdel2– 4

mat


),

located 220-kb upstream of GNAS exon A/B, have been found

in most of the patients affected with the autosomal dominant

form of PHP-Ib and exhibiting loss of GNAS exon A/B methyl-

ation alone (7, 8). Deletions removing both NESP and AS exons

(delNEPS55/ASdel3– 4

mat

) of GNAS have been identified in af-



fected individuals of two unrelated families with PHP-Ib and

broad GNAS methylation changes (9). The mechanism under-

lying sporadic PHP-Ib with maternal broad GNAS methylation

changes is yet undiscovered (Fig. 1). Because PHP-Ib appears to

be a heterogeneous disorder, we investigated the epigenetic struc-

ture of the GNAS gene in a girl presenting with PTH resistance,

typical features of Albright osteodystrophy, normal G

s



bioac-

tivity with GTP

␥S as a stimulant and no modification of the

GNAS coding exons (1–13).

Methods


The patient gave her informed consent for the genetic and epi-

genetic analyses.



Molecular analysis of the GNAS gene

Genomic DNA was extracted from blood lymphocytes. The



GNAS gene (exons 2–13) was PCR amplified and sequenced as

described previously (4). Since the 2002 report (4), we have been

able to amplify and sequence the GNAS exon 1 using the fol-

lowing primers: forward, CCTCCCGGCCCGCGTGA, and re-

verse, CTGCGGGGCGCCCTTCGA. The NESP and A/B re-

gions were amplified from genomic DNA: A/B, forward

GTCCGAAGATACGAAACTCC and reverse GCTGCCTAA-

GAGTTAGCG; and NESP, forward CGAGTCTTAGGCT-

GCGGAA and reverse ACAAGGAGAATCTGGACGGC.

Characterization of the G



s



transcripts

TotalRNAswereextractedfrombloodlymphocytes.AfterRT,the

G



s



transcripts were amplified using different primer pairs (exons

1–13, forward GGACAAGCAGGTCTACCG and reverse AGGG-

TAGCAGTAGTGACGC; exons 4–13, forward CCTGAAAGAG-

GCGATTGAAA and reverse AAGGTGCATGCGCTGAAT; and

exons 1–8, forward AGACCGAGGACCAGCGCAA and reverse

AGTCAGGACACGGCAGCGAA) and sequenced. The exons 1–8

PCR products were subcloned in a pcR4-Topo Cloning vector (In-

vitrogen, Carlsbad, CA) and sequenced using a T7 primer.



Epigenetic characterization of the GNAS DMRs

GNAS DMRs were amplified by PCR from bisulfite-treated

genomic DNA as described elsewhere (8). A/B was amplified using

the primers: forward TTTTTTTGTTTTAGAGTTTTTAGGG

and

reverse


TAAAAATACAAAACCTC-

CCCTACTC, then reamplified using the same

primers. AS was first amplified using the prim-

ers: forward TGTGTATATATTAAGGT-

TATTAGGTG and reverse AAAAATTTTA-

ATTAAAATTTAATACC, then reamplified

using the primers: forward GGTGTGGG-

TATTTATTTTTGGTTAGT and reverse TA-

ATCAATCAACTCCTTTAACCCC. XL was

amplified using the primers: forward GG-

TAGTTTATTTTAAGAGGTTGTTA-

GATTT and reverse AAAAAAATACTTTTC-

CTCCCTCC. NESP was amplified using the

primers: forward GAGGATAAAGATTTA-

AGGGATTT

and


reverse

CTCAAA-


CTCCCCAATTTAAC.

To assess the methylation status of the

amplified regions, amplicons were submit-

ted to BstUI digestion or sequenced. The



FIG. 1. Simplified map of the 20q13.3 region (STX16 and the GNAS locus) and the localization of the known microdeletions causing PHP-Ib. GNAS is a

complex imprinted locus yielding, besides G

s

, multiple alternative transcripts. These transcripts encode XL



s

, NESP55, the A/B transcript, and the



antisense (AS) transcript. NESP55, XL

s



, and A/B differ from G

s



only by their first exon. AS, XL

s



, and A/B are paternally derived transcripts, whereas

NESP55 is a maternally derived transcript. Consistent with their monoallelic expression, the promoters of these imprinted transcripts are located within

DMRs (18) (2). In contrast, the promoter giving rise to G

s



is not methylated, and accordingly, transcripts are derived in most tissues from both parental

GNAS alleles. STX16, encoding Syntaxin16, is located 220-kb upstream of GNAS exon A/B and biallelically expressed (8). Exons are depicted as blackened

rectangles, and direct repeats are shown as striped arrowheads. The deleted regions lie between the brackets; the location of the four DMRs studied are

shown (


ϩ, methylated; -, unmethylated). Arrows indicate the origin of transcription. cen, Centromeric; Mat or m, maternal; Pat or p, paternal; tel,

telomeric; X, XL

s

.



FIG. 2. Patient’s phenotype. A, Height, weight, and body mass index (BMI) of the patient (black

circle) and her parents and siblings (white circle and squares, respectively). B, Brachymetacarpy of

the fourth and fifth metacarpals.



662

Mariot et al.

Albright Osteodystrophy and GNAS Epimutation

J Clin Endocrinol Metab, March 2008, 93(3):661– 665

Downloaded from https://academic.oup.com/jcem/article-abstract/93/3/661/2597993/A-Maternal-Epimutation-of-GNAS-Leads-to-Albright

by guest


on 03 October 2017

NESP or XL amplicons were subcloned in a pcR4-Topo Cloning

vector and sequenced using a T7 primer.

Case Report

When she was 10 yr old, the patient had generalized seizure

revealing hypocalcaemia (1.4 m

M

, normal range 2.17–2.57). She



was put on calcifediol, and 2 yr later, referred to our clinic for

persistent hypocalcaemia. She was born from healthy noncon-

sanguineous African-American parents. Her siblings are healthy

(Fig. 2A).

She was obese (body mass index

Ͼ 97th centile at 12 yr and

thereafter) with a round face. She controlled her weight gain

through dietary adaptation. Her growth and pubertal develop-

ment were normal [final height of 165 cm (target height of 162.5

cm), corresponding to the mean height of women in France], she

had bilateral obvious brachymetacarpia affecting both hands

(fourth and fifth metacarpals), and the metatarsals were normal.

The x-rays confirmed the brachymetacarpia, showed the absence

of distance enlargement between the L1 and L5 vertebral

pedicles, and the absence of bone resorption features (Fig. 2B).

We did not observe ectopic ossification clinically or on hands,

feet, and spine x-rays.

None of her siblings or parents had similar bone features.

When she was 12 yr old, her laboratory tests showed: calce-

mia 2.01 m

M

, phosphatemia 2.19 m



M

(normal range 0.8 –1.6),

and PTH 399 pg/ml (normal range 10 –58). After exogenous

PTH administration, the urinary cyclical AMP increased inad-

equately (0.19 nmol/100 ml glomerular filtrate, normal range

0.59 –1.99), confirming the PTH resistance. She received alfa-

calcidol (1-

␣-25 (OH)

2

D

3



) to prevent convulsions and normalize

her blood calcium, phosphorus, and PTH. Despite alfacalcidol,

2

␮g daily, she never experienced elevated calciuria and main-



tained her PTH levels within or close to the normal range. Free

T

4



and TSH were measured at 12, 18, and 24 yr within the

normal range.

Because of the association of Albright osteodystrophy and

PTH resistance, PHP-Ia was suspected, the biological activity of

G



s



was assessed in her red blood cells, as described previously

(4), and found identical to control (CTRL) subjects (88% of three

CTRL values, normal range 75–100%).

Genetic and Epigenetic Findings

The GNAS gene (exons 1–13) was amplified and sequenced

(genomic DNA from blood lymphocytes), including the GC-rich

exon 1, and no mutation was detected. However, three poly-

morphisms were identified in the GNAS coding sequence: C/T,

position 749 (exon 5) of NM000516; C/T, position 911 (exon 7)

of NM000516; and C/T, position 1469 (exon 13) of NM000516

corresponding to the single nucleotide polymorphism rs8386.

In addition, the G

s

transcripts were amplified by RT-PCR



(exons 1–13) from the patient’s blood lymphocytes (Fig. 3). Di-

rect nucleotide sequence of the G

s

transcripts showed heterozy-



gosity at the polymorphic nucleotides 749, 911, and 1469 of the

G



s

cDNA (the third is known as rs8386), indicating that two

different alleles were amplified. Therefore, we have shown that

both GNAS alleles are intact and expressed in the patient’s lym-

phocytes, excluding large scale deletions of the GNAS coding

region (exons 1–13). The exons 1– 8 PCR amplification of the

G



s



transcripts were subcloned and sequenced. Eight out of 14

clones carried the T and T (nucleotides 749 and 911 of

NM000516, respectively). The remaining six clones carried the

C and C nucleotides at the same location.

After bisulfite treatment, GNAS exon A/B, NESP, XL, and AS

were amplified and either submitted to enzymatic digestion, or

sequenced (Fig. 4). In the absence of methylation, the DNA se-

quence is modified by the bisulfite, removing the BstUI recog-

nition sites (A/B, AS, NESP, and XL). Unlike the CTRL, and

similarly to a PHP-Ib individual, the A/B, XL, and AS patient’s

PCR products were not digested, indicating a loss of methylation

of the A/B, XL, and AS patient’s maternal allele. Likewise, the

NESP patient’s PCR product was almost fully digested, indicat-

ing a gain of methylation of the NESP patient’s maternal allele.

Direct nucleotide sequencing of the PCR products confirmed

these results. The reported patient and the PHP-Ib individual

chromatograms showed unmethylated DNA sequences of the

A/B, XL, and AS PCR products, and methylated DNA sequences

of the NESP PCR products. In summary, we found broad meth-

ylation changes of the patient’s GNAS locus corresponding to a

paternal epigenotype on both alleles (i.e. loss of GNAS exon A/B,

XL, and AS methylation, and gain of NESP methylation).

As expected, the patient did not carry the STXdel4 – 6 or the

FIG. 3. Biallelic expression of G

s



. A, Amplification of G

s



(exons 4 –13)

after RT of total RNAs extracted from the patient’s blood lymphocytes. B,

Direct nucleotide sequence of the amplified G

s



transcripts of a CTRL

individual (upper line) and our patient (lower line) displaying three

heterozygous polymorphisms, using forward (749 and 911) and reverse

(1469) sequencing primers.

J Clin Endocrinol Metab, March 2008, 93(3):661– 665

jcem.endojournals.org



663

Downloaded from https://academic.oup.com/jcem/article-abstract/93/3/661/2597993/A-Maternal-Epimutation-of-GNAS-Leads-to-Albright

by guest

on 03 October 2017



STXdel2– 4. No polymorphisms were identified in the NESP and

A/B regions of GNAS (59 –1114 of NM016592, 1076 –2054 of

AF246983, respectively). Altogether, she was diagnosed as spo-

radic PHP-Ib.

Discussion

The current report identifies an epigenetic mutation of GNAS in

one girl with typical PTH resistance and features of Albright

osteodystrophy. Direct nucleotide sequencing of the 13 exons of



GNAS as well as amplification of G

s



transcripts issued from

both alleles excluded the three types of defects usually associated

with PHP-Ia: loss-of-function mutations, paternal unidisomy, or

large deletions throughout the G

s

coding sequence. Because we



did not identify any polymorphisms in the A/B or NESP regions,

we cannot exclude a deletion in these regions as the cause of the

observed paternal epigenotype in this patient. Deletion of the

NESP and AS exons, associated with GNAS epigenetic changes,

likely removing a regulatory element of GNAS methylation, has

been described previously by Bastepe et al. (9).

Findings similar to our patient are cur-

rently reported by de Nanclares et al. (10) in

five individuals with mild features of Albright

osteodystrophy, i.e. shortness of metacarpals,

short stature, ectopic ossification, and obe-

sity. Our report confirms that Albright os-

teodystrophy or at least brachymetacarpia

and obesity are not specific symptoms of PHP-

Ia, and that the epigenetic status of GNAS

should be investigated in patients who show

PTH resistance, normal G

s



bioactivity in

blood cells, and the absence of genetic alter-

ation of the GNAS exons 1–13, regardless of

their phenotype.

The imprinting defect observed in our pa-

tient results in both alleles having a paternal-

specific epigenotype characterized by a dra-

matic decrease of methylation at exon A/B,

XL, and AS promoter regions, therefore,

likely biallelic expression of A/B, XL, and AS

transcripts. Unfortunately, because XL is not

expressed in blood lymphocytes, we were not

able to amplify XL transcripts of this patient

and identify their parental origin. The cause of

this imprinting defect remains to be found.

Because paternal expression of G

s

is signif-



icantly reduced in the thyroid, mild TSH re-

sistance may appear in some patients with im-

printing defects of the GNAS gene (5). Our

patient does not exhibit TSH resistance so far.

In such patients, the residual G

s



expression

from both paternal imprinted alleles seems to

allow a sufficient TSH signaling in thyroid

cells. In addition, the potential increase in

XL



s



expression, a GNAS product known to

share with G

s

the ability to increase cAMP



production through the stimulation of the TSH receptor (11, 12),

may compensate for the lack of G

s

.



In addition, the NESP promoter region appears fully meth-

ylated in our patient and may result in a dramatic decrease of

the NESP-specific transcripts. In humans, a specific role for

the NESP transcript (expressed in adrenals and brain) has not

yet been reported, and individuals with PHP-Ib do not seem to

have detectable adrenal or neurological abnormalities

(13, 14).

Animal studies show that G

s

is biallelically expressed in



chondrocytes and osteoblasts, and that despite the absence of

bone phenotype in G

s

-haploinsufficient mice (15, 16), chon-



drocytes with targeted monoallelic disruption of GNAS un-

dergo premature hypertrophy (17). These data suggest that

the PHP-Ia bone phenotype is related to a decrease of G

s



expression in the growth plate. Some features of AHO, par-

ticularly brachydactyly and obesity, have now been observed

in a small number of PHP-Ib patients, suggesting that im-

printing defects of the GNAS gene may affect G

s

expression



in imprinted tissues (renal proximal tubule and thyroid) and

in bone.


FIG. 4. Characterization of the GNAS broad methylation changes. A, Enzymatic digestion

(BstUI) of the PCR amplified bisulfite-treated genomic DNA. The arrow shows the uncut allele

(unmethylated); the CH3 arrow shows the cut allele (methylated). The affected PHP-Ib

individual as well as the reported patient (Pt) display a loss of exon A/B, AS, and XL

methylation, and gain of NESP methylation. B, Chromatograms of the XL PCR products. The

PHP-Ib individual and patient chromatograms show unmethylated DNA sequences. On the

other hand, the CTRL DNA displays heterozygosity, indicating the presence of two different

alleles, one methylated and one unmethylated. C, To quantify the methylation status of the

NESP and XL DMRs, the PCR products were subcloned and sequenced (in red, the methylated

cytosines). Full circles represent a methylated CpG, and empty circles designate unmethylated

CpG. Each row of circles represents a clone. Of the PHP-Ib individual and patient NESP CpG,

99.2% are methylated, whereas only 41.7% of the CTRL NESP CpG are methylated. Of the

patient and PHP-Ib individual XL CpG, 10.7 and 7.9% are methylated, respectively, whereas

46.4% of the CTRL XL CpG are methylated.



664

Mariot et al.

Albright Osteodystrophy and GNAS Epimutation

J Clin Endocrinol Metab, March 2008, 93(3):661– 665

Downloaded from https://academic.oup.com/jcem/article-abstract/93/3/661/2597993/A-Maternal-Epimutation-of-GNAS-Leads-to-Albright

by guest


on 03 October 2017

Acknowledgments

We thank the patient for her kind contribution to this report. We also

thank Pr. Bougne`res for his critical review and editorial help.

Address all correspondence and requests for reprints to: Agne`s Linglart,

Pediatric Endocrinology and Institut National de la Sante´ et de la Recherche

Me´dicale U561, Hoˆpital St-Vincent de Paul, 82 avenue Denfert-Rochereau,

75014 Paris, France. E-mail: agnes.linglart@svp.aphp.fr.

Disclosure Summary: The authors have nothing to declare.

References

1. Albright F, Burnett CH, Smith PH, Parson W 1942 Pseudohypoparathyroid-

ism–an example of “Seabright-Bantam syndrome.” Endocrinology 30:922–

932


2. Weinstein LS, Yu S, Warner DR, Liu J 2001 Endocrine manifestations of

stimulatory G protein

␣-subunit mutations and the role of genomic imprinting.

Endocr Rev 22:675–705

3. Weinstein LS, Gejman PV, Friedman E, Kadowaki T, Collins RM, Gershon ES,

Spiegel AM 1990 Mutations of the G

s

␣-subunit gene in Albright hereditary



osteodystrophy detected by denaturing gradient gel electrophoresis. Proc Natl

Acad Sci USA 87:8287– 8290

4. Linglart A, Carel JC, Garabedian M, Le T, Mallet E, Kottler ML 2002 GNAS1

lesions in pseudohypoparathyroidism Ia and Ic: genotype phenotype relation-

ship and evidence of the maternal transmission of the hormonal resistance.

J Clin Endocrinol Metab 87:189 –197

5. Liu J, Erlichman B, Weinstein LS 2003 The stimulatory G protein

␣-subunit

G

s

␣ is imprinted in human thyroid glands: implications for thyroid function in



pseudohypoparathyroidism types 1a and 1b. J Clin Endocrinol Metab 88:

4336 – 4341

6. Liu J, Litman D, Rosenberg M, Yu S, Biesecker L, Weinstein L 2000 A GNAS1

imprinting defect in pseudohypoparathyroidism type Ib. J Clin Invest 106:

1167–1174

7. Bastepe M, Fro¨hlich LF, Hendy GN, Indridason OS, Josse RG, Koshiyama H,



Korkko J, Nakamoto JM, Rosenbloom AL, Slyper AH, Sugimoto T, Tsatsoulis

A, Crawford JD, Ju¨ppner H 2003 Autosomal dominant pseudohypoparathy-

roidism type Ib is associated with a heterozygous microdeletion that likely

disrupts a putative imprinting control element of GNAS. J Clin Invest 112:

1255–1263

8. Linglart A, Gensure RC, Olney RC, Juppner H, Bastepe M 2005 A novel

STX16 deletion in autosomal dominant pseudohypoparathyroidism type Ib

redefines the boundaries of a cis-acting imprinting control element of GNAS.

Am J Hum Genet [Erratum (2007) 81:196] 76:804 – 814

9. Bastepe M, Fro¨hlich LF, Linglart A, Abu-Zahra HS, Tojo K, Ward LM, Ju¨-

ppner H 2005 Deletion of the NESP55 differentially methylated region causes

loss of maternal GNAS imprints and pseudohypoparathyroidism type Ib. Nat

Genet 37:25–27

10. de Nanclares GP, Fernandez-Rebollo E, Santin I, Garcia-Cuartero B, Gazt-



ambide S, Menendez E, Morales MJ, Pombo M, Bilbao JR, Barros F, Zazo N,

Ahrens W, Juppner H, Hiort O, Castano L, Bastepe M 2007 Epigenetic defects

of GNAS in patients with pseudohypoparathyroidism and mild features of

Albright’s hereditary osteodystrophy. J Clin Endocrinol Metab 92:2370 –2373

11. Bastepe M, Gunes Y, Perez-Villamil B, Hunzelman J, Weinstein LS, Ju¨ppner



2002 Receptor-mediated adenylyl cyclase activation through XL

s



, the

extra-large variant of the stimulatory G protein

␣-subunit. Mol Endocrinol

16:1912–1919

12. Linglart A, Mahon MJ, Kerachian MA, Berlach DM, Hendy GN, Juppner H,

Bastepe M 2006 Coding GNAS mutations leading to hormone resistance im-

pair in vitro agonist- and cholera toxin-induced adenosine cyclic 3

Ј,5Ј-mono-

phosphate formation mediated by human XL

␣s. Endocrinology 147:2253–

2262


13. Ischia R, Lovisetti-Scamihorn P, Hogue-Angeletti R, Wolkersdorfer M, Win-

kler H, Fischer-Colbrie R 1997 Molecular cloning and characterization of

NESP55, a novel chromogranin-like precursor of a peptide with 5-HT1B re-

ceptor antagonist activity. J Biol Chem 272:11657–11662

14. Plagge A, Isles AR, Gordon E, Humby T, Dean W, Gritsch S, Fischer-Colbrie



R, Wilkinson LS, Kelsey G 2005 Imprinted Nesp55 influences behavioral re-

activity to novel environments. Mol Cell Biol 25:3019 –3026

15. Yu S, Yu D, Lee E, Eckhaus M, Lee R, Corria Z, Accili D, Westphal H,

Weinstein LS 1998 Variable and tissue-specific hormone resistance in hetero-

trimeric G

s

protein


␣-subunit (G

s

␣) knockout mice is due to tissue-specific



imprinting of the G

s

␣ gene. Proc Natl Acad Sci USA 95:8715–8720



16. Germain-Lee EL, Schwindinger W, Crane JL, Zewdu R, Zweifel LS, Wand G,

Huso DL, Saji M, Ringel MD, Levine MA 2005 A mouse model of albright

hereditary osteodystrophy generated by targeted disruption of exon 1 of the

Gnas gene. Endocrinology 146:4697– 4709

17. Bastepe M, Weinstein LS, Ogata N, Kawaguchi H, Ju¨ppner H, Kronenberg



HM, Chung UI 2004 Stimulatory G protein directly regulates hypertrophic

differentiation of growth plate cartilage in vivo. Proc Natl Acad Sci USA 101:

14794 –14799

18. Hayward B, Kamiya M, Strain L, Moran V, Campbell R, Hayashizaki Y,



Bonthron DT 1998 The human GNAS1 gene is imprinted and encodes distinct

paternally and biallelically expressed G proteins. Proc Natl Acad Sci USA

95:10038 –10043

J Clin Endocrinol Metab, March 2008, 93(3):661– 665

jcem.endojournals.org

665

Downloaded from https://academic.oup.com/jcem/article-abstract/93/3/661/2597993/A-Maternal-Epimutation-of-GNAS-Leads-to-Albright

by guest

on 03 October 2017




Do'stlaringiz bilan baham:


Ma'lumotlar bazasi mualliflik huquqi bilan himoyalangan ©fayllar.org 2017
ma'muriyatiga murojaat qiling