Preparation of template dna
Download 24,71 Kb.
|
mRNA synthesis Protocol
- Bu sahifa navigatsiya:
- Figure 1
- Plasmid templates
- PCR Templates
Preparation of template DNA Linearized plasmid DNA and PCR products that contain aT7 polymerase promoter site can be used as templates for in vitro transcription with this kit. In general, any DNA with a T7 promoter site that is pure enough to be easily digested with restriction enzymes can be used for in vitro transcription. Figure 1 T7 polymerase promoter: Minimal Sequence Requirements T7 +1 TAATACGACTCACTATAGGGAGA The +1 base (in bold) is the first base incorporated in RNA during transcription. The underline shows the minimum promoter sequence needed for efficient transcription. Plasmid templates DNA templates are usually linearized prior to in vitro transcription to produce RNA of defined length. Linearize the DNA by digestion with an appropriate restriction endonuclease followed by an appropriate clean-up procedure, such as phenol extraction followed by ethanol precipitation. Start with at least 30% more DNA than is required for the transcription reaction to allow for DNA loss during purification and visualization by gel electrophoresis. The restriction enzyme used to linearize the plasmid should leave blunt ends or 5' overhangs (linearization of template with an enzyme that produces a 3' overhang will result in aberrant transcripts).DNA should be digested in a minimum volume of 10 μL per ug of DNA, using the buffer and temperature recommended for each enzyme. Linearized DNA can be used straight from the digestion reaction if desired, with only a slight reduction of yield (< 10%). However, digestion reactions must be heat-denatured at 65°C for 20 minutes prior to transcription. Template linearized DNA from restriction digestion reaction should not constitute more than 10% of the total transcription volume. Optimal RNA yields depend on a high-quality DNA template. The DNA template must be free of RNase. If the presence of RNase is suspected, treat the DNA with ProteinaseK (100 μg/mL) and SDS (0.5%) in 50 mM Tris-HCl (pH 7.5), 5mM CaCl2 for 30minutes at 37°C. Purify the DNA further by extraction with TE-saturated (pH 8.0) phenol:chloroform: isopropanol (25:24:1) and ethanol precipitation. PCR Templates DNA generated by PCR can be transcribed directly from the PCR provided it contains a T7 Polymerase promoter upstream of the sequence to be transcribed. PCR products should be examined on an agarose gel before use as a template in to estimate concentration, and to verify that the products are unique and the expected size. Download 24,71 Kb. Do'stlaringiz bilan baham: |
Ma'lumotlar bazasi mualliflik huquqi bilan himoyalangan ©fayllar.org 2025
ma'muriyatiga murojaat qiling
ma'muriyatiga murojaat qiling